                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGTCAAGCTCGGCGCCGACGGGCTCAACGGGCACCTCGACCGCAAGCTGTGGACCCT
CGGCACCGACGGTTTCGGGCGCAGTGAAGCCCGCGAAGAACTGCGTGACTTCTTCGAG
GTGGACACCAAGCACGTTGTGCTGGCGACCCTCTACGCCTTGCAGCAGCGCGGCGAGG
TGAAGGGCGAAGTCGTGGCGAAAGCGATTGCCGACCTCGGCATCGACCCCAGCAAACC
CGCGCCCGTCCTGCGCTGAccagagagggtcaatggttgatagagaggcgcagacccttctcttttcaGTG

    DR0256 Gene: DR0256     GI: 15805288     BI number: DR0256     GOG: COG0508     Description: pyruvate dehydrogenase complex, dihydrolipoamide acetyltransferase E2 componen            ag           t  a           a  g           g  a            tg            tg            gc           |  g            gc            ta           a  | ag       a  | g  a       cg a  g       ta cg        gc cg        gc At        gc Gc        at Ta        gt             ctcttttcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0508 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component, and related enzymes ... can be seen here     ..................................................................................................................