                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.70 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTACAGCGAAAACCGCCGGGCGAGCTACGCCAACTACTGGGTGCGCGGCGACCGCT
ACGCCTTCCAGGACACCTTCGAGCCTTAAagctgcgcggcggcgagtcggcccggcgaaaccgtaagaaaagctgtttc
cggcggctggcggaatttggtaacgtttccagcagtgaagaaggcggtgacgacgtgaaccaaccgtcaccgccttttttggtgcttatctggtttcacg
cccctctcttccccctgtttgttcaccgctggccgagcgtaccagcaaggagtccctgagcccATG

    DR0264 Gene: DR0264     GI: 15805296     BI number: DR0264     GOG: COG1523     Description: glycogen operon protein Glg            ac           a  c           g  a aa        ta g  g       gc t  a      c  | g  a      a  | a  g       gc cg        cg gc        at a  |       gc cg        ta cg        gc t  t       gc tg        cg ta        gc gc        gc cg        at             tttttggtgcttatctggtttcacgcccctctcttccccctgtttgttcaccgctggccgagcgtaccagcaaggagtccctgagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1523 Type II secretory pathway, pullulanase PulA and related glycosidases ... can be seen here     ..................................................................................................................