                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCCGACCCGCGCAAGGTCCGGGCGCAGCTCGACGCCGCCGCCAAGGCGCTGCCGCAG
TCCAAGACCGTCTACAAGGTCTTCGGGGTCACGCCGCAGGCCACATGGACGCCGAGTT
CCTGAtcgcgagcgccaagggcggcaagtacaccaagctgcgcgccgacaagacctacaagtaagccgctgaccgaggcggcaagacaagggcacaa
gggcgtcccggttcctgggggacgcgccttttctttccccgcccccgcttttcgccgccccgtttcccacgtgacaggagctttcccTTG

    DR0281 --- DR0282 --- DR0283 --- DR0284 Gene: DR0281     GI: 15805312     BI number: DR0281     GOG: COG0559     Description: branched-chain amino acid ABC transporter, permease protein Gene: DR0282     GI: 15805313     BI number: DR0282     GOG: COG4177     Description: branched-chain amino acid ABC transporter, permease protein Gene: DR0283     GI: 15805314     BI number: DR0283     GOG: COG0411     Description: branched-chain amino acid ABC transporter, ATP-binding protein Gene: DR0284     GI: 15805315     BI number: DR0284     GOG: COG0410     Description: branched-chain amino acid ABC transporter, ATP-binding protei cc a  g g  a tg cg gc cg cg gc |  a a  a a  g ta gc a  a a  a c  | a  | t  | c  |                  c c  |                t  c a  |                t  t g  |                g  g a  |       ag       g  g a  |      a  g       cg c  |      c  g       cg a  |      a  c       cg g  |       cg        ta cg        gt        gc cg        gc        cg g  |       gc        gc cg       a  c      |  g gc       a  g       gc c  a       cg        gc gc        at        at ta        gt        at                         ttctttccccgcccccgcttttcgccgccccgtttcccacgtgacaggagctttcccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0559 Branched-chain amino acid ABC-type transport system, permease components ... can be seen here [E] COG4177 ABC-type branched-chain amino acid transport system, permease component ... can be seen here [E] COG0411 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here [E] COG0410 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here     ..................................................................................................................