                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-26.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTACGCCGCGCTGAGCATTGCCCACCGGGGCTACGTGCTCGAAAGCGGTCAGGTGA
CTTTGCAGGGCACGGCGCAGGAACTGATGAACGATGACCGGGTGCGGAGCGCCTACCT
GGGCGTTTGAggcaggacttctctgctttctgagaaaccaagcgtcagggcagccgggcaagggaaagcacagttctcccttgtccggctcct
tttgtgccgctttgccttaatcgttccgaagctgaccatttcctgacttaatgtctttaaatccttctcacgcctctctagaatgtgaggcATG

    DR0285 --- DR0286 Gene: DR0285     GI: 15805316     BI number: DR0285     GOG: -------     Description: hypothetical protein Gene: DR0286     GI: 15805317     BI number: DR0286     GOG: -------     Description: hypothetical protei            ag           c  g            tg            gc tt       |  a c  t       cg g  c       gc         c t  t      a  c      a  a cg       a  g       cg ta        cg        gt cg        cg        at ta       a  c      a  c ta       a  a       at c  a      a  a       gc a  |      g  g       gc gc       a  |       gc gc       g  |       at |  a       tg        at a  a       cg        cg cg        ta        gt gc        ta        gc g  g       ta        gc At        cg        cg Gc        gc        cg Ta        ta        gc                         tccttttgtgccgctttgccttaatcgttccgaagctgaccatttcctgacttaatgtctttaaatccttctcacgcctctctagaatgtgaggcATG     ..................................................................................................................