Gene putatively regulated by attenuation in D_radiodurans_1
Characteristics of the secondary structures
Terminator: Distance to gene:58 nt. Distance to run of Ts=0 nt. Size=37 nt. Delta G=-26.50 kcal/mol
Antiterminator: Size=44 nt. Delta G=-13.06 kcal/mol
Anti-antiterminator: Size=46 nt. Delta G=-19.50 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
GGTCAGACGCTGACCCACGCCAGCCGCCCGCGCTCGGCGAGCACCGCCGTGGGCTACA
CCAGCGTGCACGTCCGCGAACAGGCCAAGGTCATCGCCGACGCGCTCGGTGAGCCGAT
CACCCGTCAGGACGTGGACGCCCAGGTGCCGCTCACCGAGGAAGCGAGCGCTCAGGGC
TGAgcccgcaccacaaagcagcaaagaggaggggaggcccgcgcaggcgccttccccctcttcttttattgcctgcctgcttgctgaccttttgaagc
ccggacggtgcaggcgctacgctgagccATG
DR0288
Gene: DR0288 GI: 15805319 BI number: DR0288 GOG: ------- Description: hypothetical protei
AG
G C a
CG c g
GC g c
A | a a
AT a a g
GC a a c c
G A c g g a
A G a a cg
G | cg cg
CG cg | c
CG a a cg
| C c g gc
AT g | gc
CG cg at
TA cg gt
Cg cg gc
Gc g a gc
| c A | gc
C c G | a |
Cg Tg gc
Gc Cg gc
Ta Gc at
Gc Gc gc
Gc Gc at
tcttttattgcctgcctgcttgctgaccttttgaagcccggacggtgcaggcgctacgctgagccATG
..................................................................................................................