                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.90 kcal/mol
Antiterminator:    Distance from promoter:78 nt. Size=23 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tacact. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagattcggcaaccctctgtacactagctgagctgttcGGGGCTGTGGCGCAGTTGGGAGCGCGTCTGAATG
GCATTCAGAAGGTCAGGGGTTCGAATCCCCTCAGCTCCAccagagaggacgttgcttacgggcagcgtcct
ttttcttggtctggcttgctttgaaccagtctccgctcaattcccgtttaacctggctttgatctgacgggactacactgaacgctgtcgagccgccccc
ggcgcggttccccaaggagacccccATG

    DR0292 Gene: DR0292     GI: 15805323     BI number: DR0292     GOG: COG1826     Description: conserved hypothetical protei            ac           t  g ag        tg c  a       cg c  g       gc A  a       ta Cg        tg Cg        gc Ta        cg |  c       at Cg        gc Gt        gc At        at Cg        gt             tttcttggtctggcttgctttgaaccagtctccgctcaattcccgtttaacctggctttgatctgacgggactacactgaacgctgtcgagccgcccccggcgcggttccccaaggagacccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG1826 Sec-independent protein secretion pathway components ... can be seen here     ..................................................................................................................