                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGGCCGAAGCCAACCGCGCCTACGCGCACTACCGCTGGTAAtttccggcgtctgggtgactggccc
agagtggctgtgcggggcacaagcatccgtttctttgtaatgaaactgctggcagcgtaacgctgagagtggtggaatagagatgaagcggcctgcccgc
ctcccagccggacgcggacggtggagcgcctttgccccgccgtccgctcgcctcgggctgagttacccagcaggactagcaggaagatccatcacggcca
cctgacggtgccgccgtattacagggagtcttATG

    DR0307 Gene: DR0307     GI: 15805336     BI number: DR0307     GOG: COG0480     Description: elongation factor tg g  a gc gt t  | cg tg gc c  | gc gc c  a cg ta tg t  t A  g A  |                 ca Tg                 a  a Gc                  cg Gt         g        gc Tg       g  g      |  a |  t       cg        gt Cg        gc        gc Gc        ta        gc Cg        gc        cg Cg        ta        gt                         ttctttgtaatgaaactgctggcagcgtaacgctgagagtggtggaatagagatgaagcggcctgcccgcctcccagccggacgcggacggtggagcgcctttgccccgccgtccgctcgcctcgggctgagttacccagcaggactagcaggaagatccatcacggccacctgacggtgccgccgtattacagggagtcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0480 Translation elongation factors (GTPases) ... can be seen here     ..................................................................................................................