                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.04 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGACCTGAACAGCCGTCGTGGCCAGATTCAGGGTATGGAAGCCCGCGGCAACGCGCA
GATCGTCAAGGCGTTCGTGCCGCTCTCGGAAATGTTCGGCTACGCGACCGACATGCGT
TCCAAGACCCAGGGCCGCGCCAGCTACTCGATGTTCTTCGATCACTACACCCAGGTGC
CCACCAACCTGGCGCAGCAGTTGATGAAGAAGTAAgacctccgggtctgaaaagctcacctttcggggtgggct
tttttcgtttcaactggcgcctaaagacccctgccctgttaacctgcgggccATG

    DR0308 Gene: DR0308     GI: 15805337     BI number: DR0308     GOG: -------     Description: hypothetical protei CA C  C C  C G  A TA GC GC AT CG CG |  C |  G C  C A  A C  G A  C TA CG |  T AT        cc CG       t  g TA        cg AT        cg G  |       at CG        gc TA        At        tc TA       A  g      t  g CG       T  a       tg TA       G  a       cg TA       A  a       cg G  G      A  a       at T  T      G  g       cg A  A      A  c       tg G  A       At        cg Cg        Gc        gc Ta        Ta        at                         tttttcgtttcaactggcgcctaaagacccctgccctgttaacctgcgggccATG     ..................................................................................................................