                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-25.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.12 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCCTATGGCATCCCCGAAGGCCTGATCTACGGCTTCCCCGTGCGCGTCAAGGACGG
CAAGTACGAAATCGTGCAGGGCCTGGACGTGAGCGACTTCAGCCGCGGCAAGATGGAC
GCCACCGCCCAGGAACTCGAAGAAGAACGCGACGAAGTGCGCAAGCTCGGCCTCGTCA
AGTAAgacagcactgagaaataggagggcagagggccagcgacggctctttgcccccctttcttttgtgcctgggttctttcgtgcctgtattcttt
gggcttgtgcttttgcctaaactgcccctATG

    DR0324 Gene: DR0324     GI: 15805353     BI number: DR0324     GOG: COG3404     Description: serine cycle enzyme, putativ            ac           g  a           A  g           A  c            Ta            Gc            At           |  g CA       |  a G  A      |  g       cg CG       |  a      g  a GC       |  a      a  c |  T      |  a       cg |  C      |  t       cg |  G      |  a       gc TG       |  g       gt GC       |  g       gc A  C      |  a       at AT       A  g       gt GC        Cg        at CG        Tg        cg AT        Gc        gc GC       |  a       gc C  A       Cg        gc G  A       Ta       a  c CG        Cg        gc AT        Cg        gc                         tttcttttgtgcctgggttctttcgtgcctgtattctttgggcttgtgcttttgcctaaactgcccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3404 Methenyl tetrahydrofolate cyclohydrolase ... can be seen here     ..................................................................................................................