                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCGCCCTGCCCGTCCCCGCCGCAGCGCCGAACCCGAAGCCGTCCGCACCGAGGATG
CGCCCCAGCCCAACGCCGAAGCGAGCGAGGCCGGCGAAAACACCCCGGCAGCCTGAgc
tttttctagcatcctggcccctgaccgcaactggtcggcgggcctttttgcgttccaggctcacccgctctccgagcattcgcctgtctcccccacagga
acgcggcggcgcgggcgttgctggcctccggggcgcctcggcacggtatggtgagtcgtaaaaccatcctcaggagggatacccATG

    DR0325 Gene: DR0325     GI: 15805354     BI number: DR0325     GOG: COG0039     Description: malate dehydrogenas AA A  C       tt A  A      t  c G  C      t  t C  C       ta GC        cg GC        gc CG       |  a CG        At GC        Gc        aa G  A      |  c      c  c A  |      T  t       gt G  |       Cg        cg CG        Cg        cg GC        Gc        at |  C      |  c       gc |  T      |  c       tg A  G      |  c       cg G  A       At       |  c Cg        Cg        cg Gc       |  a       cg At        Gc        cg At        Gc        gc Gt        Cg        gc                         tttttgcgttccaggctcacccgctctccgagcattcgcctgtctcccccacaggaacgcggcggcgcgggcgttgctggcctccggggcgcctcggcacggtatggtgagtcgtaaaaccatcctcaggagggatacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here     ..................................................................................................................