                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.45 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-31.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAGGCCGGGGCTACACCCGCGGCGGCAACGACCGGGGCGCCGCCCGCCTGAACGGC
AACGGTGGCCCGGGCGCCGGACGTGGAAGCCAGGGCCAGCCGCGCTCCGCTGCTCCCC
GCGCCGCTGCGCCCCAGGCTCCTGTGGCCGCCGCCGAGCCGGTGCAGAACAGTGCTCC
CAGCGACGCCCAGAGCGAGGAAGCGCGTCGCCGCCGCCGCCGCCGGGGCCGCCGGGGT
GGGGCACCGGGCAGCGCCGAATAAgcctcctctgatagcaaccgtccgcgtgacagcgggcggtttttTTG

    DR0351 Gene: DR0351     GI: 15805380     BI number: DR0351     GOG: COG4291     Description: hypothetical protei   C G  C G  G GC GC CG        cc CG       g  t G  |      A  c CG       A  c CG       T  t GT       A  c CG       A  t CG       G  g G  |      C  a CG       C  t CG       G  a GC        Cg |  A       Gc |  C      |  a       ga |  C      |  a      t  c |  G      |  c      g  a CG       A  c       cg CG        Cg        gc GC        Gt        cg C  A       Gc        cg T  |       Gc        tg G  |       Cg        gc CG       |  c       cg GC        Cg        cg CG        At        at GC        Cg        at                         tttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4291 Predicted membrane protein ... can be seen here     ..................................................................................................................