                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-22.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-21.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCACGGGCCGCGTCTGGCTGGCCCCCACCTTGCCGCTGCACGCTTAGggctgaggccgggcg
tacactcgggggatggcccccgctttcccccacccctggctgtgcgtgctcggtgggctgtgattgcctgctccccttttgctggggctcctgctctggc
aggcggcccggcaccccggcacgggctggacctgctattttccggcaaacccacttgtggtggctctacttttcgctgcgctgctggcgctctggctggg
accggggctgatgttgctgcgctgggggtataagaaGTG

    DR0369 --- DR0370 Gene: DR0369     GI: 15805398     BI number: DR0369     GOG: -------     Description: hypothetical protein Gene: DR0370     GI: 15805399     BI number: DR0370     GOG: COG1427     Description: conserved hypothetical protei            cc           c  c ct       a  g t  g       cg cg        gc gc       |  a ta        gc cg        cg cg        cg |  c       cg tg        gc cg        gt g  |       cg gc       |  g gc       |  a gc        gc tg        gc cg        at gc        cg ta        gc             tattttccggcaaacccacttgtggtggctctacttttcgctgcgctgctggcgctctggctgggaccggggctgatgttgctgcgctgggggtataagaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1427 Predicted periplasmic solute-binding protein ... can be seen here     ..................................................................................................................