                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-28.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATACGGGATGCCGCCCGCCGGGGGCCTGGGCATCGGCATAGACCGGCTGGCGATGCTG
CTCACCGACTCGGATTCCATCCGCGACGTGCTGCTGTTCCCGCTGCTGCGGCCCGAAG
GCGGCGAGGCGGAAGAAGCTGACGACACCGCGCAGGAAAACACCGCCGGCTGAagccctgg
gcaaggtgcgggggcgtggggttgatgcctgcgcccccgctttgttttgggccggagcggtggcccctaaatctacagaactgacgaaagggaggggaag
cgtcaccgcctacactgcgcggtATG

    DR0373 Gene: DR0373     GI: 15805402     BI number: DR0373     GOG: COG0387     Description: cation exchanger, putativ   g g  c g  a ta cg cg |  t        g cg       t  a gc       t  t a  g      g  g A  g       gc G  g       gc Tg       g  t Cg       t  g Gc        gc |  g       cg Gt        gc Cg        gc Cg        gc G  |       gc Cg        gc Cg        cg At        gc             tttgttttgggccggagcggtggcccctaaatctacagaactgacgaaagggaggggaagcgtcaccgcctacactgcgcggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0387 Ca2+/H+ antiporter ... can be seen here     ..................................................................................................................