                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-19.90 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-22.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCCGTATGCCCCAGAAATCAACCAGCAGATTCTGGTGCACTGCTACGCGCTCGCGG
TGGGCTGGCAGCAGATGGCGCCCACGTTCGGGCAGGCACCGCACCCCGAATATCAGTT
CGTCGAGGGCGAGGCGGCTTTTCAGCTGGCCCTCGAAGCCGTCATCGAACGGCTGGCG
CCTCGGCTGGACTGAattctcttccccggcgcctgctccccgtccgtcgggggtttcttgtcgtgtgggcgtctcacctgaccggacgg
ggtactggcaaggtcagcggcgaggcggcggaatagaGTG

    DR0377 Gene: DR0377     GI: 15805405     BI number: DR0377     GOG: COG1760     Description: L-serine dehydratase, alpha subuni TC A  G C  A TA GC CG        Aa CG       G  t GC       T  t AT       C  c |  G       At A  G       Gc GC        Gt CG       T  t        c |  C      C  c      t  c |  C       Gc       c  c T  T       Gc        gc C  C      C  c       tg CG       T  |      c  t CG        Cg       c  c GC        Cg        gc GT        Gc        cg TG        Cg        gt CG        Gc        gc |  A       Gc        cg GC       T  t       cg AT        Cg        cg CG        Gc        cg TA        Gt        tg                         tttcttgtcgtgtgggcgtctcacctgaccggacggggtactggcaaggtcagcggcgaggcggcggaatagaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1760 L-serine deaminase ... can be seen here     ..................................................................................................................