                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-22.00 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAGCTCCCCAGCCTGCGCTTCGACTACGGCTACAGCGGCCAGAACGCCCAGAAGCC
CAACGGACGCTTCCACTTCCGCATCGGCAACTTCTGGTAAgcctgacggcgggcaggtaacacccacagg
caggcggctccccagcgggccgtctgcttttttccagttcccgcttcttctttgtttctccctgacgctatcctgccgcactggcccgtgacctgttctg
tcgctgtggccgaggaggacgtatgaccgcttctgctcctggcctgggccgtccgccctgacgccgaccgtcTTG

    DR0380 --- DR0381 --- gcp Gene: DR0380     GI: 15805408     BI number: DR0380     GOG: COG1738     Description: conserved hypothetical protein Gene: DR0381     GI: 15805409     BI number: DR0381     GOG: -------     Description: hypothetical protein Gene: gcp     GI: 15807628     BI number: DR0382     GOG: COG0533     Description: O-sialoglycoprotein endopeptidase, putativ   a c  c a  c a  c ta gc g  a a  g cg gc g  a g  g                 tt cg        ca       t  t gc       c  g      t  t g  |      c  c      c  c c  |       cg        gc a  |       tg        ta g  |       cg        cg t  |       gc       t  t cg        gc       g  t cg        cg       c  | gc        gt       c  | At        gc        gc A  c       at        gc T  c       cg        gc Gc        gc        cg Gc        gt        gc Ta        at        at                         tcttctttgtttctccctgacgctatcctgccgcactggcccgtgacctgttctgtcgctgtggccgaggaggacgtatgaccgcttctgctcctggcctgggccgtccgccctgacgccgaccgtcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.40 kcal/mol Antiterminator: Size=32 nt.     Delta G=-22.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCAGCTCCCCAGCCTGCGCTTCGACTACGGCTACAGCGGCCAGAACGCCCAGAAGCC CAACGGACGCTTCCACTTCCGCATCGGCAACTTCTGGTAAgcctgacggcgggcaggtaacacccacagg caggcggctccccagcgggccgtctgcttttttccagttcccgcttcttctttgtttctccctgacgctatcctgccgcactggcccgtgacctgttctg tcgctgtggccgaggaggacgtatgaccgcttctgctcctggcctgggccgtccgccctgacgccgaccgtcTTG     DR0380 --- DR0381 --- gcp Gene: DR0380     GI: 15805408     BI number: DR0380     GOG: COG1738     Description: conserved hypothetical protein Gene: DR0381     GI: 15805409     BI number: DR0381     GOG: -------     Description: hypothetical protein Gene: gcp     GI: 15807628     BI number: DR0382     GOG: COG0533     Description: O-sialoglycoprotein endopeptidase, putativ cg g  g       ca g  g      c  g cc       c  c aa        cg gg        tg tg        cg ct        gc ca        gc ga        cg Ac        gt Aa        gc Tc        at Gc        cg Gc        gc Ta        gt             tttttccagttcccgcttcttctttgtttctccctgacgctatcctgccgcactggcccgtgacctgttctgtcgctgtggccgaggaggacgtatgaccgcttctgctcctggcctgggccgtccgccctgacgccgaccgtcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................