                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGAcccgcagcctgacctctgccgagctgcgcgggggggcggctccctccgtcactgacccagtgatgcccgcccgcgtctcccccgcccgcttgc
cggataccccgcacctcgggtgggcgatggtgaacctggggctgctgaccctgctcggcggcgccttgtcgcggctgttctgattgcagcgcccctttcg
cagaactctggcccgttccgtggtggacgggctttttgctggtaattctattgtcaccactctggtacgtacacttaacctctaagtctcttatgctgag
cccATG

    DR0422 Gene: DR0422     GI: 15805449     BI number: DR0422     GOG: COG4106     Description: conserved hypothetical protei   g t  t c  t gc gt cg |  a g  t c  t tg gc ta t  | c  | cg gc cg gc gc        gg c  |      t  c       tg gc       c  c      g  g gc       t  c      c  t |  t       cg        cg |  t       at        tg c  t       at        ta t  c       gc        gc cg       a  c       cg gc        cg        cg ta        gt        cg cg        cg        gc                         tttttgctggtaattctattgtcaccactctggtacgtacacttaacctctaagtctcttatgctgagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4106 Trans-aconitate methyltransferase ... can be seen here     ..................................................................................................................