                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-22.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-27.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTGCGCGGGCTGGGGCCGGATGCCTACGCCTACTTCGTCCACTCGTACTACGTGC
CGGTGGACGTGCCGGTCACCGACGGCGCCGTGACCGACTACGGCGTGCCGTTCTGGTC
GGCGCTGAGCCGGGGCAACCTGCACGCCGCGCAGTTTCACCCCGAAAAAAGCGGGGCG
GTGGGGCTGGCGCTGCTGGCGAATTTCCGCCGCGAACTCGCCCCGGCCTGAttccgccgggg
gcgctttttctgctacactgtcacggttgcacgtccgcccccgcccccggctgcttgccgatgaGTG

    DR0427 Gene: DR0427     GI: 15805454     BI number: DR0427     GOG: COG1825     Description: general stress protein Ctc, putativ   A A  A A  A A  G GC CG CG        TT CG       A  T CG       A  C |  C       GC |  G       CG |  G       GC AT        GC        At CG       T  |      G  t T  G       CG       T  c T  G       GC       C  c TG        TG        Cg GC       |  A       Gc AT       |  A       Gc |  G      |  C       Cg CG       |  T       Cg GC       |  C       Cg CG        CG        Cg GC        GC       G  g |  T      C  C      C  | |  G       GC       T  | |  C       GC       C  | |  T       TG       A  | CG        CG       A  | CG        GC        Gc GC        GC        Cg CG        GT        Gc                         tttttctgctacactgtcacggttgcacgtccgcccccgcccccggctgcttgccgatgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1825 Ribosomal protein L25 (general stress protein Ctc) ... can be seen here     ..................................................................................................................