                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGAGGAACTCGAAGCCGAAGTCCAGGCCGCGCAGGTGGCCGGTCTGGTCGCTGCCGG
CGAACTGTCCGAAGAAGCTGCCGAAGCCGTGCTCGAAGGCGACGCCAGCCTGGAAGAA
GTCAAGGCCGAAGCCAGCGAAGACAACGCTGGCACCGACAGCGAAGACAACAGCGACG
CCCAGTAAgcgccgctcagtcgttcactgcgtcccttgcggggggcgcagttttttattggcgtccggtggacccgaccgtaggctggcgtgcg
gcctccggcggcgtggctgttcatgacgctgaTTG

    DR0428 Gene: DR0428     GI: 15805455     BI number: DR0428     GOG: COG3695     Description: conserved hypothetical protei             t           c  c           g  a           c  g           c  t            gc            cg            gt            At           A  c            Ta        gc            Gc       t  g   G        At        tg A  T      C  |       cg C  A      C  |       cg C  A       Cg        cg Cg        Gc        tg Gc        Cg        gc Cg        At        cg A  c       Gc        gc Gc       C  c       ta Cg        Gc        cg Gc        At        at                         tttttattggcgtccggtggacccgaccgtaggctggcgtgcggcctccggcggcgtggctgttcatgacgctgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3695 Predicted methylated DNA-protein cysteine methyltransferase ... can be seen here     ..................................................................................................................