                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions

ATGCCCCGCTTCACCGAAGCGCAACTCAGCGCCCAGCAGGTGGCCGACGTGCACGCCT
ACATCAAGACGCTGTACTGAgcattccggttttggctgtccccccgctgcccggcgggggtttttcttgtttggccgcctgaccg
ctaagcgttttgccgctcctcgctgcgccacttggccgatgcgcgcagggccgcgtctcaaggaacatgcaacgcggcgtggtggtccggtgcggcgcgg
gcaggcaccatcagacatccctctagaaagagcacctcacacaagcgagacgacgacATG

    DR0430 Gene: DR0430     GI: 15805457     BI number: DR0430     GOG: COG1690     Description: rtcB protei           cc          g  c           tg           cg           gc           cg           cg           cg           cg           cg             tttttcttgtttggccgcctgaccgctaagcgttttgccgctcctcgctgcgccacttggccgatgcgcgcagggccgcgtctcaaggaacatgcaacgcggcgtggtggtccggtgcggcgcgggcaggcaccatcagacatccctctagaaagagcacctcacacaagcgagacgacgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1690 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.40 kcal/mol Antiterminator: Size=74 nt.     Delta G=-18.70 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G= -9.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGCCCCGCTTCACCGAAGCGCAACTCAGCGCCCAGCAGGTGGCCGACGTGCACGCCT ACATCAAGACGCTGTACTGAgcattccggttttggctgtccccccgctgcccggcgggggtttttcttgtttggccgcctgaccg ctaagcgttttgccgctcctcgctgcgccacttggccgatgcgcgcagggccgcgtctcaaggaacatgcaacgcggcgtggtggtccggtgcggcgcgg gcaggcaccatcagacatccctctagaaagagcacctcacacaagcgagacgacgacATG     DR0430 Gene: DR0430     GI: 15805457     BI number: DR0430     GOG: COG1690     Description: rtcB protei            cc           c  c           c  g            cc            tt            gg           t  c            cc            gc           g           t            t            t            t           g           g           c   G        c A  A       t A  C       t C  G      a  | T  C      c  | AT       g  | CG       A  | AT       G  | TA        T C  C       C C  |       A GT        T CG       G  | A  A      T  | Cg        C Gc        G        cc Ta       C  |      g  c Gt        A        tg C  t       G        cg A  c      A         gc Gc        A        cg Cg        C        cg Cg        T        cg Gt        A        cg                         gtttttcttgtttggccgcctgaccgctaagcgttttgccgctcctcgctgcgccacttggccgatgcgcgcagggccgcgtctcaaggaacatgcaacgcggcgtggtggtccggtgcggcgcgggcaggcaccatcagacatccctctagaaagagcacctcacacaagcgagacgacgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1690 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................