                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-26.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGGTGATGTCGCTGGCCGGATACAAGCCGGAACTCATCGCCTCGGGCCTGCTGACG
AGCGGCAACGCCAACGCGATTCTGTGGATCATGGCTTTGCTGCTCCCCGCCGTCGCCT
ACTTCCTGACGTTGGCGATCGTGCGCGGCATCCGCTCCCTGCGTGAAGCCGACGAGCG
TGACCGCCTGGCCCACGGTGGGCACGGCGGCGTGACCCCCGGCCACTCGCACGACTGA
gccccgcccctcctgagcagccctggcctgagcgccggggctgctttttttggcctcttctcggagctTTG

    DR0437 Gene: DR0437     GI: 15805464     BI number: DR0437     GOG: -------     Description: hypothetical protei            cg           c  c           c  c           c  c            gc            At            Gc           T  c           C  |           A  |            Gt        ga            Cg       t  g           A  a      c  c            Cg        cg            Gc        gc CA       C  |       gc G  C       Ta        tg CG        Cg        cg TA       |  c       cg C  C      |  c       cg AT       |  c       gc CG        At        at |  A       Cg        cg Cg        Cg        gc Gc        Gc        at Gc        Gc        gt                         tttttggcctcttctcggagctTTG     ..................................................................................................................