                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTGCTGCAAGTGCTCGCTCCCGCCACCTTGCCTCGAATGCAGCACGAAGCCCGCGA
AAGTGCCCGCCAGTACGACTTGCCGGTGCGGGCGCAGGCGCTGGAAGAGGTCTATGAA
CGGGTCATTGCGGCGCGGCGCGGCAAGGGAGCGCCTTCCCGATTTTTCCGGTCTGCCA
GCCGGTAAacgccatttggcagatgcgggcgcggagggctgacgcctagcctgagcgcatgaaccaccttcaccttttgaatgctggggagcag
ttctcgcccgagctggccgtcagctgcgtgcgGTG

    DR0445 Gene: DR0445     GI: 15805472     BI number: DR0445     GOG: COG5504     Description: hypothetical protei            GA   T       T  A T  G      A  C C  C       TG A  C       CG G  G       TG CG        GT AT        GC         A TG       A  A      A  G GC       G  |      C  G A  G       AT       G  G CG        AT       G  A CG       G  G       CG GC        GC        GC CG        TG        CG |  C       CG        GC |  A       GC        GC CG        CG       C  T CG        GC       G  T GC       G  G      C  C TG       A  |       GC GC        CG        GC AT        GC        CG                         ATTTTTCCGGTCTGCCAGCCGGTAAacgccatttggcagatgcgggcgcggagggctgacgcctagcctgagcgcatgaaccaccttcaccttttgaatgctggggagcagttctcgcccgagctggccgtcagctgcgtgcgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG5504 Predicted Zn-dependent protease ... can be seen here     ..................................................................................................................