                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-20.70 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGGTCGGCGGCACGTCCCAGGTGAGTTCGCTGGCGACGCTCAGCCAGTAGTCGCCC
GCGGGCATGTCGCGGAGCTGCTGCGCCCGCTCGGGCGTGACGGGGGCGGTCTTTTTCA
GGGCGTCGGTGGGTGAAACGAGGGGAGTCGTCAAGAGTGCGGGGTCCATagcagtcctccgggg
gtgaattgtgcggtctgcacagaatagccgaagaacctaacgaacgtttgtgaggctgtctgaccgtgaaagcgtcgcccggcgccgttcctgcggccct
gaccctctacaatcctccccGTG

    DR0461 --- DR0462 Gene: DR0461     GI: 15805488     BI number: DR0461     GOG: COG1521     Description: conserved hypothetical protein Gene: DR0462     GI: 15805489     BI number: DR0462     GOG: COG0614     Description: hypothetical protei             A           C  T           G  G            GT            GC   G        CG        CT A  C       GC       G  C C  C       CG        CG TA        CG        CG CG       |  A       CG GT        CG        GC |  A       GC        CG CG       C  T       GT AT        TG       |  G GC        GC       |  A CG        AT       |  C GC        TG       |  G GC        GC       |  G T  C      |  G      |  G CG       |  C       TG GC       A  C       CG CG       C  C       GC TG        CG        TG TG        GC        CG GC        AT        GT                         CTTTTTCAGGGCGTCGGTGGGTGAAACGAGGGGAGTCGTCAAGAGTGCGGGGTCCATagcagtcctccgggggtgaattgtgcggtctgcacagaatagccgaagaacctaacgaacgtttgtgaggctgtctgaccgtgaaagcgtcgcccggcgccgttcctgcggccctgaccctctacaatcctccccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1521 Putative transcriptional regulator, homolog of Bvg accessory factor ... can be seen here [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here     ..................................................................................................................