                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-22.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGTGTTTCCCTACGGCACCCGCGTGACCATTCAGGACCTCTCGGGCCGCTACAACT
TCGCCGGACGCGTGTTCATCGTCGAAGACACCATGCACCCCCGCAAGACCAATCAGGT
GGACATCTGGATGCCCACCTACCGCGACGCCATCAGCTTCGGCACCAGCACGGTGCGG
ATTACCGCTCTGCGCTGAgcctcagtccactggccctggcctgcgccgctctgcatgacggcggcgggtcggggctttttcggcttc
tcgccctcggacgcccggctgcgctagcctcggccctgcATG

    DR0487 --- DR0486 Gene: DR0487     GI: 15805514     BI number: DR0487     GOG: COG4591     Description: conserved hypothetical protein Gene: DR0486     GI: 15805513     BI number: DR0486     GOG: -------     Description: hypothetical protei cc t  a gc at cg tg         c |  c      g  a |  c      t  t |  c       cg |  t       ta cg       c  | cg        gc gc        cg A  c       cg G  t       gc T  |      |  g Cg        cg Gc        gc Cg        tg Gc        cg T  c       cg C  |       gt T  |       gc Cg        tg Gc        cg             ggctttttcggcttctcgccctcggacgcccggctgcgctagcctcggccctgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4591 ABC-type transport system, involved in lipoprotein release, permease component ... can be seen here     ..................................................................................................................