                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCGGACCATGGCCCGCGCCTCGCGCCAGGAAGAGGGCAACCTGCGCTACGACCTCG
CCCGCGAGCGGACGGAGAGCGGCGTGCGGCTGCATATCAGCGAGCGCTACCGCGACGA
GGCCGCCGTGCAGGCCCACCGCGACTCGGCGCACTACCAGGCCTACCGCGCCAAAGCC
GGCGCGTGGCTGGCCGAGCCGCCGCAGGTCAGCGTGCTCGAAGAAGTAGACGTGGCGG
GCTAAgtttctgctgccccggcaagccgctccccgtgtgggggcggttttttcatgccctagactccgGTG

    DR0493 --- DR0494 --- DR0495 Gene: DR0493     GI: 15805520     BI number: DR0493     GOG: COG0266     Description: formamidopyrimidine-DNA glycosylase Gene: DR0494     GI: 15805521     BI number: DR0494     GOG: COG0563     Description: DNA topology modulation protein FlaR-related protein Gene: DR0495     GI: 15805522     BI number: DR0495     GOG: COG0259     Description: pyridoxamine 5-phosphate oxidas tc t  t tg gc At A  | T  | Cg Gc Gc Gc |  c |  g |  g        t |  c      g  g |  a      c  t |  a       cg Cg        cg Gc        cg Gc        tg Tg        cg Gc        gc C  |       cg At        cg Gc        gt             tttttcatgccctagactccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0266 Formamidopyrimidine-DNA glycosylase ... can be seen here [F] COG0563 Adenylate kinase and related kinases ... can be seen here [H] COG0259 Pyridoxamine-phosphate oxidase ... can be seen here     ..................................................................................................................