                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCTCGCGCGCGTGGTGCCGCTCGCCCTGCTGTCGGGCATCGTCGCCTGGCTGATTT
CGCGGGTGATGCCGGCCCCCGGGTTCTTCTTGCCGGGCCTGTTTGGGCTCGCGGTGGC
GGGTGGAGCGGGGCTGCTCGTCTACCTGCTCGGCGCCACGCTGCTGAAGATGCCGGAG
ATGGCGGGGCTGCTGCGGCGACTGAAACGCTGAgccccggcaaaacgcgggcgggggagaagggctgaacttttga
ccgggttcagcttttttcccctgcccagtttcaggcactagcctgggagcATG

    DR0499 --- DR0500 Gene: DR0499     GI: 15805526     BI number: DR0499     GOG: COG2084     Description: 3-hydroxyisobutyrate dehydrogenase Gene: DR0500     GI: 15805527     BI number: DR0500     GOG: COG1307     Description: conserved hypothetical protei   G T  A C  A A  A        c GC       a  g CG       a  c GC       a  g GT       a  g CG        cg G  |       gc T  |      g  g       ga C  |       cg       t  c G  |       cg       t  c TA        cg        tg Cg        cg        tg Gc       |  a       cg Gc       |  g       at Gc       g  a       at Gc       A  a       gc Cg       G  g       ta G  g       Tg        cg Gc        Cg        gc Ta        Gc        gt                         tttttcccctgcccagtttcaggcactagcctgggagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG2084 3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases ... can be seen here [S] COG1307 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................