                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGACGCGCCGATCAGCAGCAGGTTTTTCTTCATctgacctttattgtaacgtctggaagttcagccgatg
gtcaggcgctgtctcccggcgtccatacccaggagacgacactcaaatagacatctgccagtgtcttctcagcggtgcgggctaccctgaccccatgttc
gccgcccgccttcttagttctggggacctcaccgcctgagtttcccggcgcggcaccggcccccttcccagcgtggaggggggatttttcgtctggccga
acatgaagagccaaacgtggaggaattTTG

    DR0504 --- DR0503 Gene: DR0504     GI: 15805531     BI number: DR0504     GOG: COG0500     Description: conserved hypothetical protein Gene: DR0503     GI: 15805530     BI number: DR0503     GOG: COG1520     Description: hypothetical protei   t t  t g  c a  c gc tg cg |  c cg gc cg        gc cg       a  g |  c      c  t a  a       cg c  c       cg t  c       ta cg        tg cg        cg a  |       cg gc        cg gc        cg gc        cg             atttttcgtctggccgaacatgaagagccaaacgtggaggaattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here [S] COG1520 FOG: WD40-like repeat ... can be seen here     ..................................................................................................................