                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -9.62 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCGGGCGAGCTGCCCCCCAGCGCTGCCCCAGGGTCAAAGCGGGCGAGGGCCTGAcg
tttgacagacgtttgacacctgcccctcagcgtcacaaacggtaggccctgggccaaaagtaaaaccccgtcgagtgcggggtttttgttggTGCAC
CCTGTAGGACTCGAACCTACGACCGACCGCTTAGAAGGCGGTTGCTCTATCCAGCTGA
GCTAAGGGTGCgcggcgcacaaagcgcggaagacactttagcatccgggcaggcgggggcaagggcgcacccggcgcggcctgtcctATG

    DR0512 --- DR0511 Gene: DR0512     GI: 15805539     BI number: DR0512     GOG: COG0697     Description: conserved hypothetical protein Gene: DR0511     GI: 15805538     BI number: DR0511     GOG: COG0600,COG1116     Description: ABC transporter, ATP-binding protei tg c  c c  c a  c        t c  c      c  g at        cg gc        cg t  |       gc ta        gc tg       a  a gc       t  a cg       g  a at       g  a gc        cg a  a       at c  |      |  a a  |      a  a gc       a  a ta       c  a        a ta       a  c      g  g ta       c  c      c  t gc       t  c       tg cg        gc        gc A  g       cg        cg Gt        gt        cg Ta       a  c       cg Cg        cg        cg Cg        ta        at Gc        cg        at                         tttgttggTGCACCCTGTAGGACTCGAACCTACGACCGACCGCTTAGAAGGCGGTTGCTCTATCCAGCTGAGCTAAGGGTGCgcggcgcacaaagcgcggaagacactttagcatccgggcaggcgggggcaagggcgcacccggcgcggcctgtcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here     ..................................................................................................................