                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-18.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctcacaccctctcgcccctgttttcacgcgctgggcgggcggttctgggctgttcggtgtgacgcgctcagtgtgcgccggggggcaacatttacccggt
ttttcccagtttgggcagcgctggggggcgtttttgcttacacggcgcccagttctgccccgtttttgctcgcacgcggcgcggttttgcccggtgctgg
gcggcaagtggcgaaaacttgcccggtattttttcgcctttgcctgagcctgggcagcgctggggggtagacctggcacccctggggcggggcggtcacg
GTG

    DR0527 Gene: DR0527     GI: 15805554     BI number: DR0527     GOG: -------     Description: hypothetical protei tt t  t tg gc        tt c  t      g  t        g c  c       gt       c  a c  |       cg       g  a cg        gc       g  a gc       c  |       ta ta        gc        gc c  c       gc        at t  |       cg       a  | tg       g  |      c  | gc        cg       g  | a  |       at        gt c  |       cg        cg cg        gc        gc cg       |  t       gc gc        cg        gc cg        tg        tg gc        cg        cg g  g       gc        gt cg        tg        ta at        tg        gt                         tttttcgcctttgcctgagcctgggcagcgctggggggtagacctggcacccctggggcggggcggtcacgGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.00 kcal/mol Antiterminator: Size=38 nt.     Delta G=-19.90 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G=-10.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ctcacaccctctcgcccctgttttcacgcgctgggcgggcggttctgggctgttcggtgtgacgcgctcagtgtgcgccggggggcaacatttacccggt ttttcccagtttgggcagcgctggggggcgtttttgcttacacggcgcccagttctgccccgtttttgctcgcacgcggcgcggttttgcccggtgctgg gcggcaagtggcgaaaacttgcccggtattttttcgcctttgcctgagcctgggcagcgctggggggtagacctggcacccctggggcggggcggtcacg GTG     DR0527 Gene: DR0527     GI: 15805554     BI number: DR0527     GOG: -------     Description: hypothetical protei             t           c  c           g  a            cg            gt tg        cg c  t       at gt       g  | Gc        tg Tg        gc        ac G  g       tg       a  a gt        gc       c  t cg        gc       g  t at        cg       g  t cg        tg       g  a ta        tg        gc gc       g  g       gc |  g       tg        gc gc        cg        cg cg        gc        cg                         tttttcccagtttgggcagcgctggggggcgtttttgcttacacggcgcccagttctgccccgtttttgctcgcacgcggcgcggttttgcccggtgctgggcggcaagtggcgaaaacttgcccggtattttttcgcctttgcctgagcctgggcagcgctggggggtagacctggcacccctggggcggggcggtcacgGTG     ..................................................................................................................