                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctcgggcggctcccacacaagagggaaccggttccactgaaaagggctcgaaaagggagagctctaaggggttggtcaccgcgcggccccggcccgtga
gcgagcacggcccaagcaagggggaggccgctccgtggaggtcaaggcagcaaaggggcgggacaggcccggcggtggtgagtcggtatggctcggcagc
agtataaccgacccccggttatgttttttcctgaactgacactcatggtaggccgggcatggtaggccgggcatggtaggccgggcatggtgggccgggc
ATG

   ق Gene: DR0560     GI: 15805587     BI number: DR0560     GOG: COG1651     Description: conserved hypothetical protei   c g  a g  g c  c ta cg         c gt       c  c g  a      a  c t  t       gc a  a       cg ta        cg gc        at gc        at cg        ta ta        at gc        tg             ttttttcctgaactgacactcatggtaggccgggcatggtaggccgggcatggtaggccgggcatggtgggccgggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1651 Protein-disulfide isomerase ... can be seen here     ..................................................................................................................