                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCAACCCCGTGGTCGCCGGCTTCTCGCGCACCATCAGCGCAGGCACCCCGATGCCC
AACATTCCTGAAATGGGCGCGGTGTGGGGGCCCTGGACCAACGCGATCACCCAGGTGG
CGCAAAAGCCCGGTCAGAACTACTCCCAGCTCCTGACCAAGGCCGTGGGTGAGATTAA
GGGCAATATCAAGTAAcagaattccccggctcagaggcgcggcatagtccgtgcccctgggcctcttttcctttttagcccgctgagg
gtgctcgctcttcgtgctgactgtttctgggagtttctATG

    DR0562 --- DR0563 Gene: DR0562     GI: 15805589     BI number: DR0562     GOG: COG1175     Description: maltose ABC transporter, permease protein Gene: DR0563     GI: 15805590     BI number: DR0563     GOG: COG3833     Description: maltose ABC transporter, permease protei AT T  C A  A A  A CG GT |  A G  A G  c A  a                 ta A  g                a  g Ta                 c  t Ta                  gc At                  gc Gt                  cg A  |                 gt G  |                 cg T  |                 gc Gc        ag        gc Gc       c  a      a  c Gc        tg        gc T  |       cg        at Gc        gc        cg Cg       |  g       tg Cg        gc        cg Gc        cg        gc Gt        cg        gc                         tcttttcctttttagcccgctgagggtgctcgctcttcgtgctgactgtttctgggagtttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG3833 ABC-type maltose transport systems, permease component ... can be seen here     ..................................................................................................................