                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-19.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.54 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-20.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGTGGCGCTGTTCTACTCCTTCCAGAACTACTTCGTCGGCGGCGCGACGGCGGGTG
GGGTCAAGGAATAGgcccttttttccggcgcgtctctccggccccctgcctcagtggcggggggtttttgatgagcaatcgctcaccaga
caaaatctgacctttcttgtattcttttgcggttgccgtgcccgcgctccttttccgaacggaaggaaaatacagccccggacggcgtggcatagagttc
gtgccagagcagtctgtgtacgtgagtcacaaggcccccgaggaggccccccATG

    DR0564 --- DR0565 Gene: DR0564     GI: 15805591     BI number: DR0564     GOG: COG0834     Description: amino acid ABC transporter, periplasmic amino acid-binding protein Gene: DR0565     GI: 15805592     BI number: DR0565     GOG: COG0765     Description: amino acid ABC transporter, permease protei GA G  A A  T        t A  A      g  c CG       c  t Tg       g  c Gc       c  t Gc        gc Gc        gc Gt        cg T  t       cg Gt       t  c        a Gt       t  c      c  g G  t      t  c      t  t C  t      t  c       cg Gc       t  c       cg Gc       t  t       gc Cg       c  |       tg A  g      c  |       cg Gc        cg        cg Cg        gc        cg Gc        Gc        cg Cg        At        cg                         tttttgatgagcaatcgctcaccagacaaaatctgacctttcttgtattcttttgcggttgccgtgcccgcgctccttttccgaacggaaggaaaatacagccccggacggcgtggcatagagttcgtgccagagcagtctgtgtacgtgagtcacaaggcccccgaggaggccccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here     ..................................................................................................................