                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-19.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGCCGAGCCGAGCTTCTCAAACGCCTCTTCAAAGGGGGTGCGCGACAAAATCGCG
GGGCGGGCCACTGAAAACCTCCTGGGGAACGGGCCGAACAGGTCAGGCCGGCCCCAGT
GGCCGCCAGTCATGTTCAGGGATGGAAGCACgtattgtcgccctacatatatacgttaaagctaacagctggcaagg
ggatacccccattccccgtcccagcgccccttgagcgtcatagactcagattgtcagcttcggtcagttgacatttttcttatcggcgctctaccatccg
tgacggaTTG

    DR0606 Gene: DR0606     GI: 15805633     BI number: DR0606     GOG: COG0234     Description: chaperoni   c c  c c  c        a a  a      c  t t  t      t  a at       g  g gc       c  a gc        gc gc        at gc        gc a  g       ta a  t       tg c  c      |  a gc       |  t gc       c  t ta       c  g cg       c  t gc       c  c |  g      g  a       gg |  c       cg       c  t |  c       gc       t  c |  c       at        ta a  c      c  t       cg c  t      c  |       gt a  t      c  |       at a  g      t  |       cg ta        gc        ta cg        cg        gc gc        cg        ta                         tttttcttatcggcgctctaccatccgtgacggaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0234 Co-chaperonin GroES (HSP10) ... can be seen here     ..................................................................................................................