                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.82 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAATCCCGCatgttgcacgcaaaatctggTCGGGAAGACAGGATTCGAACCTGCGACCCCCTGGTC
CCAAACCAGGTGCGCTACCGGCCTGCGCTACTTCCCGgacgcgtgcacaaaaaagtataccggaaggagacag
accccggcaagggggcccggcaaagcgtccctttttttgcttccccggctgcgccatactgtccgtgctgcccgctgtggcacgcggcgacggggaaccg
acgggcgacatccctctccaggccgttctgcgagacgctgccccgcgcccaaggagaatctATG

    DR0640 Gene: DR0640     GI: 15805667     BI number: DR0640     GOG: COG0192     Description: S-adenosylmethionine synthas aa a  a c  a a  a cg gt ta         c gt       g  a c  a      g  a g  |       cg c  |       cg a  |       cg gc        cg Gc       a  g C  |      g  c Cg       a  |       gc Cg       c  |      g  a Ta       a  |      c  a Ta       g  |      c  a Cg       a  |       cg A  g      g  |       gc Ta       g  |      |  g Cg       a  |       gt G  a      a  |       gc C  |       gc        gc Gc        gc        gc Ta        cg        at Cg        cg        at                         tttttgcttccccggctgcgccatactgtccgtgctgcccgctgtggcacgcggcgacggggaaccgacgggcgacatccctctccaggccgttctgcgagacgctgccccgcgcccaaggagaatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0192 S-adenosylmethionine synthetase ... can be seen here     ..................................................................................................................