                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions

CCCCTGTAACAGTGACGGCCCCGCCATCATGGAAAGCCGCATGATCGCCCAGGCGAGC
GCCGACGGCAAGGTCACGCTGACGGGCATCGTGCCCACCGCGCTGATCCGCGACGCGG
CGTACATCAACGTGCACCACGGGCGCGACTTCAGCGGCGCGCTGGCCGACAGCGGCGT
GATCTGCACCCCGATCACGATGACGATGCGCTGAgcattcctctatccagaaccgcctccacaccgggggcggtt
tttctttgcctgtgcccagggagggcgcagcggctatcctcgcaggatgagGTG

    DR0643 --- DR0642 --- DR0641 Gene: DR0643     GI: 15805670     BI number: DR0643     GOG: COG0742     Description: N-6 adenine-specific DNA restriction methylase, putative Gene: DR0642     GI: 15805669     BI number: DR0642     GOG: COG0669     Description: lipopolysaccharide core biosynthesis protein KdtB Gene: DR0641     GI: 15805668     BI number: DR0641     GOG: -------     Description: hypothetical protei            a          c  c          a  c           cg           cg           tg           cg           cg           gc           cg           cg           at           at           gt             ttctttgcctgtgcccagggagggcgcagcggctatcctcgcaggatgagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0742 N6-adenine-specific methylase ... can be seen here [H] COG0669 Phosphopantetheine adenylyltransferase ... can be seen here     ..................................................................................................................