                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCACCTACGCCCAGGCCGTGCGCTACGACGAGGCCCAGGCGCAACAGCTGGGCATTA
CCGGCGTGCCGTTTTTCGTGCTGGGCGGCAAGTACGGCGTGAGCGGTGCCCAGGCCCC
CGAAACCCTGCTGGGAGCGCTCAGTCAGGTCTGGGCCGAACAGCACCCCGCCCCGCTG
ACCATGCTGGGCCAGGACGCCCCCGCCGAGGGCTGCGAGGACGGCCAGTGCGCGGTGC
CCCAGCGCCCTAACAACTGAggggagagaacgaggctgctctggcgaaagctagggcggctttttcttATG

    DR0658 Gene: DR0658     GI: 15805685     BI number: DR0658     GOG: COG0491     Description: conserved hypothetical protei gg g  g A  a G  g Ta Cg A  a A  a C  c       aa A  g      g  a A  |       cg Ta        gc Cg        gt Cg        ta |  c       cg |  t       tg Cg        cg Gc        gc C  t       tg Gc        cg At        gc Cg        gt Cg        at             tttcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................