                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTCTTGGTGGCGGCGCCCGCATCGGCGTGAACTTGAACATCGCCAACTGAactgtcatt
gttcattgccccggtggtcggctgaccgctggggattttttatgcctcatggttgacccttccgcgttccactgctaccctgtgtgcatagctatgcgta
attttgcatagtcattcatccgatgcagaccctgaccgcccgacgctgacgcttccgcctgacccttccgggacacgggcggacgcttcacgtctgggcg
tcttgcgctgcctttacagaaaaaggggagaatcacaccATG

    DR0674 --- DR0675 --- DR0676 --- DR0677 Gene: DR0674     GI: 15805701     BI number: DR0674     GOG: COG0137     Description: arginosuccinate synthase Gene: DR0675     GI: 15805702     BI number: DR0675     GOG: COG0454     Description: hypothetical protein Gene: DR0676     GI: 15805703     BI number: DR0676     GOG: COG0454     Description: acetyltransferase, putative Gene: DR0677     GI: 15805704     BI number: DR0677     GOG: COG0454     Description: acetyltransferase, putativ             c           t  a           g  t           t  t            cg            at            At            Gc            Ta           C  |            At cA        At c  T       Cg a  G      |  c       gc c  T      |  c      g  t aT       C  c       cg cG        Gc        ta tA        Cg        gc a  A       Tg        gc a  C       At        tg g  A       Cg        gc aT       A  g       gt gC        At        cg g  G       Gc        cg gC        Tg        cg gC        Tg        cg                         attttttatgcctcatggttgacccttccgcgttccactgctaccctgtgtgcatagctatgcgtaattttgcatagtcattcatccgatgcagaccctgaccgcccgacgctgacgcttccgcctgacccttccgggacacgggcggacgcttcacgtctgggcgtcttgcgctgcctttacagaaaaaggggagaatcacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0137 Argininosuccinate synthase ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................