                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-29.80 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAAACAACGGCGGCTCCAGCTGGAGCGCGAGCGCCACGGCCCCCGCTGCGGGCGCCA
AAGTGTGCGCGGGTGTGGACACCAACAACGATGGCAAAGTCGACGCGGCTGACATCCT
CAAGCCCGGCGAAACCATCACCGTGACCTACCAGGTCAAGGTGAACTGAggcctctcgtgaggc
ggcgccctcctgcctgcgggcggggcgtgcgccgcctcttttgcacttccttttgttctgccccaacacgagaagcctatttttcaagcaagcagagtcg
ttcctgatctgggaggcaccGTG

    DR0686 --- DR0687 --- DR0688 Gene: DR0686     GI: 15805713     BI number: DR0686     GOG: NOG43924     Description: conserved hypothetical protein Gene: DR0687     GI: 15805714     BI number: DR0687     GOG: NOG18814     Description: hypothetical protein Gene: DR0688     GI: 15805715     BI number: DR0688     GOG: NOG15605     Description: conserved hypothetical protei                      gc                     t  g                      cg                      cg                      gc                      tg             c        cg           c  c       cg           g  t       tg cg       c  c      |  c t  t       gc       c  g cg        gt       c  t ta        cg        cg cg        gc        gc cg        gc        cg gc        at        gc g  g      g  |       gc A  g       tg        cg Gc        gc        gc Tg        cg        gc                         tcttttgcacttccttttgttctgccccaacacgagaagcctatttttcaagcaagcagagtcgttcctgatctgggaggcaccGTG     ..................................................................................................................