                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGGCACGCAGTTCCTCAGCGCGGCTGACGACGGCGATGCGGGCAGCCTCAACACTG
GCCGCGTGCTGGTCAATGGCCTCCCCGCGCGTCTGGAGCCGGGGCAGCAGTATCAGGT
CTGCTTCCGCGCGACCATCAAATAAccccttagtttcctgagcaggccgtctccccgtgaggcggtctgttttgcgtttgcc
ttcgccgcgcggcaagctccgggaaaagaacgaaaagccaaaggcccgctgaacccgccgcgcccggtcaggcggcagactacccggcaaaggagtccac
ccATG

    DR0689 --- DR0690 --- DR0691 Gene: DR0689     GI: 15805716     BI number: DR0689     GOG: COG0692     Description: uracil-DNA N-glycosylase Gene: DR0690     GI: 15805717     BI number: DR0690     GOG: COG3569     Description: type I topoisomerase, putative Gene: DR0691     GI: 15805718     BI number: DR0691     GOG: -------     Description: hypothetical protei CA T  G A  G       ct T  T      c  t GC       c  a AT        cg CG        At GC        At AT       T  t C  |      A  c G  |      A  c GT        At         c GC        Cg       c  g GC        Ta       c  t CG       |  g       cg |  C      |  c       ta CG       A  a       cg GC        Cg        tg |  G       Cg        gc A  A      A  c       cg GC        Gc        cg GC        Cg        gt TA        Gt        gc                         tgttttgcgtttgccttcgccgcgcggcaagctccgggaaaagaacgaaaagccaaaggcccgctgaacccgccgcgcccggtcaggcggcagactacccggcaaaggagtccacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0692 Uracil DNA glycosylase ... can be seen here [L] COG3569 Topoisomerase IB ... can be seen here     ..................................................................................................................