                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-14.30 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-24.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCTGAGCAAGGTGGACACCGCCCGCGAAACCACTGCCGACCACGACGGCTGCGCGG
TGGTGCTCGTCGCCCGCGAATAAaaaccggttttgactcttattcccactacctgcaggtggtgggatttttgttgtgcagct
tgtttctaaaattctgtacatcagacttgcgagagccacaccgtagaaaagatcgagctataaatctgcaaagtgtcgtcacaaaatttgcatttgtcca
gatttatctgtacatcctgcactgatttccctatgctgaccttcggagcggctgccggaGTG

    DR0692 --- DR0693 Gene: DR0692     GI: 15805719     BI number: DR0692     GOG: COG0347     Description: nitrogen regulatory protein P-II Gene: DR0693     GI: 15805720     BI number: DR0693     GOG: COG0004     Description: ammonium transporte             A           T  A           A  a           A  a           G  a           C  c   G        Gc C  A       Cg A  C       Cg CG       |  t CG       |  t A  C      C  t GT        Gt CG        Cg |  C       Ta CG        Gc GC       |  t TG       |  c CG       |  t AT       |  t CG       |  a CG       |  t AT       C  t |  G      T  c |  C      C  c |  T       Gc        gc |  C       Ta       t  a A  G       Gc        cg AT        Gt        cg GC        Ta        at CG        Gc        tg GC        Gc        cg C  C      C  |       at C  C       Gt        cg CG        Cg        cg GC        Gc        cg CG        Ta        ta                         tttttgttgtgcagcttgtttctaaaattctgtacatcagacttgcgagagccacaccgtagaaaagatcgagctataaatctgcaaagtgtcgtcacaaaatttgcatttgtccagatttatctgtacatcctgcactgatttccctatgctgaccttcggagcggctgccggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0347 Nitrogen regulatory protein PII ... can be seen here [P] COG0004 Ammonia permease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.50 kcal/mol Antiterminator: Size=64 nt.     Delta G=-14.30 kcal/mol Anti-antiterminator:   Size=25 nt.     Delta G= -9.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGCTGAGCAAGGTGGACACCGCCCGCGAAACCACTGCCGACCACGACGGCTGCGCGG TGGTGCTCGTCGCCCGCGAATAAaaaccggttttgactcttattcccactacctgcaggtggtgggatttttgttgtgcagct tgtttctaaaattctgtacatcagacttgcgagagccacaccgtagaaaagatcgagctataaatctgcaaagtgtcgtcacaaaatttgcatttgtcca gatttatctgtacatcctgcactgatttccctatgctgaccttcggagcggctgccggaGTG     DR0692 --- DR0693 Gene: DR0692     GI: 15805719     BI number: DR0692     GOG: COG0347     Description: nitrogen regulatory protein P-II Gene: DR0693     GI: 15805720     BI number: DR0693     GOG: COG0004     Description: ammonium transporte             a           g  c           t  t           t  c           t  t           t  t            ga            gt            ct           |  c           |  c           c  c            aa            ac            at            Aa           |  c           |  c           |  t           |  g           |  c           |  a           A             T   CT       A   G  C       A        gc T  G       G       t  a GT        C        cg GC        G        cg TG        C        at GC        C        tg GC        C        cg C  |      G  |       at GC        C        cg CG        T        cg GC        G        cg TG        C        ta                         tttttgttgtgcagcttgtttctaaaattctgtacatcagacttgcgagagccacaccgtagaaaagatcgagctataaatctgcaaagtgtcgtcacaaaatttgcatttgtccagatttatctgtacatcctgcactgatttccctatgctgaccttcggagcggctgccggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0347 Nitrogen regulatory protein PII ... can be seen here [P] COG0004 Ammonia permease ... can be seen here     ..................................................................................................................