                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATCGGCGAGGAGATCAAAAAGACCTCGCGCCGCGTGAACGCACTTGAACAGGTGGT
TATCCCCGGCATTCACGACGACATCCGCTTCATTCGCAGCGTGCTCGACCAGCGCGAA
CGCGAAGCCGGCTACACCCAGAAGAAGATCAAGGCCAAGATCGAGGGCAAGAACAAAG
AAGCCCGCGAAGCCGCCGCCGCGACCAGCCACGGCAGCGCCGCCGACTGAagtcggtcagcca
gaagccgccctccatgtgggggcggtttttttgtagcaacggacaggtcattaaactgcctccATG

    DR0703 --- DR0704 Gene: DR0703     GI: 15805730     BI number: DR0703     GOG: COG4297     Description: conserved hypothetical protein Gene: DR0704     GI: 15805731     BI number: DR0704     GOG: COG1896     Description: hypothetical protei            GA           T  a            Cg   C        At A  C       Gc G  A       Cg CG        Cg GC        Gt C  C      C  c       tg C  A      C  a      a  t GC       G  |       cg CG        Cg        cg CG        Gc       t  | GC       |  c       cg C  A      |  a       cg CG       |  g       cg GC       |  a       gc A  G      A  a       cg A  C       Cg        cg GC        Gc        gt CG        Gc        at GC        Cg        at                         ttttgtagcaacggacaggtcattaaactgcctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4297 Uncharacterized protein containing double-stranded beta helix domain ... can be seen here [R] COG1896 Predicted hydrolases of HD superfamily ... can be seen here     ..................................................................................................................