                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-19.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-26.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTCTGTGCCCTACACGCTGACCGGCAGTGCGAGCGGCGAACTGTATGGCACGGCCC
GCAGCCAGCAAGGCACCGTCAGTGGTGCGGCCACCCTCGCCGTCACCCCGCGCTGAgg
ccagtggcctgagccgcccggcaacccgcttttctggcttctctgccaggagcgggttttgtcgtgagtcatattttgtcttgagtcatacagccaaggg
cgctcaaagcagcgtcagaaagaaagccgctgcacatatggccggtgacaggctgggaatgctgtctggccggaggactccctcATG

    DR0707 --- DR0706 --- DR0705 Gene: DR0707     GI: 15805734     BI number: DR0707     GOG: NOG47598     Description: hypothetical protein Gene: DR0706     GI: 15805733     BI number: DR0706     GOG: COG3868     Description: hypothetical protein Gene: DR0705     GI: 15805732     BI number: DR0705     GOG: COG2342     Description: conserved hypothetical protei CC A  C C  C TG GC CG        cc C  C      g  c GT        cg CG        cg TA        gc Cg       |  a Cg       a  a |  c      g  c       ct |  c      t  c      t  c |  a      c  c      t  t Cg        cg        cg At        gc        gc Cg        gt        gc Cg       |  t       ta Gc       |  t       cg Gc       t  t      t  | |  t       gc       t  | C  g       at        tg G  a       cg        ta Tg        cg        cg Gc        gc        gc Gc        gt        cg Tg        At        cg Gc        Gc        cg                         ttttgtcgtgagtcatattttgtcttgagtcatacagccaagggcgctcaaagcagcgtcagaaagaaagccgctgcacatatggccggtgacaggctgggaatgctgtctggccggaggactccctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3868 Uncharacterized conserved protein ... can be seen here [G] COG2342 Predicted extracellular endo alpha-1,4 polygalactosaminidase or related polysaccharide hydrolase ... can be seen here     ..................................................................................................................