                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-23.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCACACCTCGACATCGCCGGCAACGCCGAAAAAGACAGCGTGGCGACCGGCTGGGG
CGTGGGCACGCTGGTGGAGTACGTGCTGGCGCAGGGCTGAtcccactctgaaaaagagtttgcttatgcg
agctctttttccaaacggagtgagtcagagaaaatacgggtctggacggcgcgaaggagagttcagacccgtatgagctttacccaggcagtgtggggca
gggccgccggattaaccctctcccctgcccccgcttcatcccgccgccgcttgtgggcggtttagtggagggATG

    DR0716 --- DR0715 --- DR0714 Gene: DR0716     GI: 15805742     BI number: DR0716     GOG: COG2041     Description: conserved hypothetical protein Gene: DR0715     GI: 15805741     BI number: DR0715     GOG: COG3663     Description: G/U mismatch-specific DNA glycosylase Gene: DR0714     GI: 15805740     BI number: DR0714     GOG: -------     Description: hypothetical protei   G T  G G  A G  G T  T       tc C  A      A  c GC        Gc CG        Ta AT       C  | CG        Gc GC        Gt GT        Gc G  G       At TG        Cg GC       G  a CG       C  a GC       G  a G  A      G  a G  G       Ta        ta G  |       Cg       t  t TG       G  a       cg CG       T  g       gc GC       G  t       tg GT       C  t       ta CG        At        tg C  A       Tg        gc At        Gc        at Gc        At        gc                         tttttccaaacggagtgagtcagagaaaatacgggtctggacggcgcgaaggagagttcagacccgtatgagctttacccaggcagtgtggggcagggccgccggattaaccctctcccctgcccccgcttcatcccgccgccgcttgtgggcggtttagtggagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2041 Sulfite oxidase and related enzymes ... can be seen here [L] COG3663 G:T/U mismatch-specific DNA glycosylase ... can be seen here     ..................................................................................................................