                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATGTCGTAGAAGACGAGTTCGTCGGCCTGTTGCGCCTCGTAGGCCTGCGCGAGCAC
CAGCGGGTCGCCCGCGTCGCGGTGATCCTCGAAAAAGCGCACGTTTTTGACCACGCGG
CCATTTTGGACATCCAGGCAGGGAACGATGCGTTTGGCGAGCACGCCCCGCAGCATag
cggccccgcgcccggcgccgacgcgttgtgcagatcggcagagcgtttttgacccgccgtcatgtcacaatgtgttcacgaaaccttgactcttctttta
gataatgaggttctggaggcccactcATG

    DR0731 Gene: DR0731     GI: 15805757     BI number: DR0731     GOG: COG0784     Description: response regulato gc c  c gc cg cg c  c cg gc gc cg        at g  a      g  c a  c      a  g T  g       cg A  c       gc Cg        ta Gt       g  g At        ta Cg        tg Gt        gc Cg        cg             tttttgacccgccgtcatgtcacaatgtgttcacgaaaccttgactcttcttttagataatgaggttctggaggcccactcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here     ..................................................................................................................