                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-14.54 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-28.10 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGACGGCACCCGCGCCGGCTTCGACCTGGAAGCGACCCGCGCCGTGGCCCGCGAG
GTGGACCTGCCGGTCATCGCGTCCGGGGGCGCGGGCAAGGTGCAGGACTTTTACGACG
TACTGACCGCTGGCGAGGCCGACGCCGCGCTCGCTGCCAGCGTCTTTCATTTCGGCGA
ACTGACGGTGCCGCAGGTCAAGACCTCCCTCGCCGCGCAGGGCGTGCCGGTGCGGCCC
GAGTGGCGGGGCGCTACCGAATAAaaccgcgtgcccgctgacctttttgcccccacggaggatgtgccATG

    DR0733 Gene: DR0733     GI: 15805759     BI number: DR0733     GOG: COG0139,COG0140     Description: phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphohydrolas AA C  G TA GC GC AT C  C G  C C  C       GG C  T      C  T GC        CG TG        GC GC        TG        AT GC       G  |      A  A CG        CG       G  A |  C       GC       C  a A  G       GC       C  a GC        GC       A  c TA       A  G      T  c CG       C  A       Cg |  G      G  |       Gc |  G       CG        Cg A  C       GT        Gt A  G       CG       |  g GT        CG        Gc CG        GC        Gc GC        CG        Gc GC        TG        Cg CG        CG        Gc TG        CG        Gt                         gacctttttgcccccacggaggatgtgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0139 Phosphoribosyl-AMP cyclohydrolase ... can be seen here [E] COG0140 Phosphoribosyl-ATP pyrophosphohydrolase ... can be seen here     ..................................................................................................................