                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-37.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGAGTATCTCCATCGAAGAGGCTTCGCTCAGCACCGAAGAAGAGAGCGCCGCCGAG
GACAAGTCGGACAAACCGAGCGCCTGAattctcctctcctcagaaggcccaccctgcacacgcggcggtgggccttttgc
tgttgatcgatgggtgtccctagagtgttcgacataagaatgctttggatttttgaccctctaccctggtgggagagggccttgcgaagcaaggggtgag
ggggtctttttgtatccaatgctctaagcgcccagcagcaagtttcctcctatttctttggcTTG

    DR0750 Gene: DR0750     GI: 15805776     BI number: DR0750     GOG: COG2199,COG2200,COG2202     Description: sensory box/GGDEF family protei ca a  c cg gc tg cg |  c cg cg at cg cg cg gc gc at at gt at cg |  c t  t c  g c  t t  t       gt cg       t  c ta        gc c  t       gc         a c  c       gt       c  t t  |       ta       a  a cg       |  g      g  a ta       |  a       cg t  t      a  g       ta a  |       gt        ta A  |       cg        gt G  |      t  t       tg Tg        at        gc Cg        gc        at Cg        tg        gt Gt        ta        at Cg        gc        tg Gt        ta        cg                         atttttgaccctctaccctggtgggagagggccttgcgaagcaaggggtgagggggtctttttgtatccaatgctctaagcgcccagcagcaagtttcctcctatttctttggcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here     ..................................................................................................................