                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGACCGGCGCGTTCGCCTGCCCCGCGTAGGGCAAGTTGGCGTAGGTGAAGGTCTGCGC
CTCGCCAGTCGTGGTCGTGCTCTTGCCGCGCACGGCGAACAGGGCGAGGGCGATCAGC
GCGGCGGCGACCAGGGTGCCGATGATCAGGACGCTGCGGTTCTGATTGTTTCCGGAAA
GTCGGGTCATGCTGCCCGGCAGTCTACCGGCTTCCCGGCGCCTGCATTCGGGGCCGCT
GTCCCCACCCGGCACACCTGCCGCAACCCCTCCCCCGGCCTCCACCCCCACaggcttacatt
ttcacgTTG

    DR0752 --- DR0751 Gene: DR0752     GI: 15805778     BI number: DR0752     GOG: COG2894     Description: septum site-determining protein Gene: DR0751     GI: 15805777     BI number: DR0751     GOG: COG0851     Description: conserved hypothetical protei GA C  A G  C       AG G  A      C  G C  G       CG A  G       AT CG       G  | GC        CG CG        GC |  A       GC G  G       CG CG       G  A CG        GT GC        CG TG       |  A TA       G  T |  T      C  C       TG C  C      G  A      C  C TA       A  G      G  G CG        CG        CG GC        TA        AT TG       A  |       GT GC        GC        GC CG        CG        AT TG        GC        CG GC        GT        TA                         TTGTTTCCGGAAAGTCGGGTCATGCTGCCCGGCAGTCTACCGGCTTCCCGGCGCCTGCATTCGGGGCCGCTGTCCCCACCCGGCACACCTGCCGCAACCCCTCCCCCGGCCTCCACCCCCACaggcttacattttcacgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG2894 Septum formation inhibitor-activating ATPase ... can be seen here [D] COG0851 Septum formation topological specificity factor ... can be seen here     ..................................................................................................................