                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTGCTCGTACAACGGCCACGAGGTCCGGCTCTCGCCCAAGGAGTTTGACCTGCTCA
CGTTCCTGGCGCGGCAGCCGGGCCGGGTCTATTCACGTCAGGAAATTGAGCGCGAGGT
CTGGAACGGTGAACTCCCCAGCAACTCGAACGTGGTGGATGTCCACATGGCGAACATG
CGCGCCAAGCTGCGTGACCTCGACGGCTACGGCGTGATTCGCACGGTGCGCGGCATCG
GGTACGCGCTCAAAACGCCATAAagcgcacctgaggaaagggggcctgccgggtgcgggcctctttttGTG

    DR0782 --- DR0783 --- DR0784 Gene: DR0782     GI: 15805808     BI number: DR0782     GOG: COG3191     Description: conserved hypothetical protein Gene: DR0783     GI: 15805809     BI number: DR0783     GOG: COG0494     Description: MutT/nudix family protein Gene: DR0784     GI: 15805810     BI number: DR0784     GOG: COG0494     Description: MutT/nudix family protei CG A  C TG GC GT GC |  A |  A C  A T  A A  C CG GC GC |  A |  T |  A |  A |  a Cg        gg         g Gc       a  g      g  g Cg       a  g      c  t Gc       a  g       cg Ta        gc        gc Gc        gc        tg Gc        at        cg C  |      |  g       cg At       |  c       gc Cg        gc        gc G  a       tg        gt Cg        cg        gc Tg        cg        gt                         ttttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EQ] COG3191 L-aminopeptidase/D-esterase ... can be seen here [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................