                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=55 nt.     Delta G=-20.84 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTGCTGTGCCTCGCCGCCACGCCGCTCGTCGTGCGCTTCCTGCCCCCGGCGGTCAT
CAGCAAGGAGCAGATTGACCAGGTGGTCGCCGCCTTCGAGCGCGTGCTGAACAATGTC
AACCCCCGCGAGGAGAGGCAAGCCGAACTGCGCGCCCAGCAGAGCGAAATGGGCCAGC
AACAGGTCAGCCAGGGCGAGAGCGTCCAGACCGAGTAAtcagggctgggagagagggccggggccagggcgc
tccggccttttttctgcctgcccttttcccggctcgtcctcttatgctgagcccATG

    DR0793 --- DR0792 Gene: DR0793     GI: 15805819     BI number: DR0793     GOG: COG0262     Description: conserved hypothetical protein Gene: DR0792     GI: 15805818     BI number: DR0792     GOG: COG0534     Description: conserved hypothetical protei            TA           G  A            At            Gc           |  a            Cg            Cg           A  g GA        Gc A  G       At GC        Cg CG        Cg GT        Tg GC       G  a GC       C  g       gg A  A      G  a      a  g C  |      A  g      c  c C  |      G  a       cg G  |      A  g       gc A  |      G  g       gt CG        Cg        gc TA        Gc        gc GC        Gc        cg GC       G  g       cg |  G      A  g       gc A  A       Cg        gc CG        Cg        gt AT        Gc        at                         ttttctgcctgcccttttcccggctcgtcctcttatgctgagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0262 Dihydrofolate reductase ... can be seen here [V] COG0534 Na+-driven multidrug efflux pump ... can be seen here     ..................................................................................................................