                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-22.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-33.82 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCGCCAAGCCCACCCTGACCAACACCCAGCTGCTCAACCTGCTCACCTCCACCGCC
AAGGACCTCGGCGCGGCGGGCAAGGACAACGACTTCGGCTCCGGCCTCGTCAACCCCC
TCAAGGCAATCACCGGGCAGTAAccccacagaggggggcgaacccccagcggcagccggcagaacaagacccccggctgccgc
tgggggtttgcggctgggggtttttcgtgggtgcggccccccgaccgccagcgccccgggctcggcgccgaacctgtgcacgggactgctaccctccgcg
cATG

    DR0811 Gene: DR0811     GI: 15805837     BI number: DR0811     GOG: COG3169     Description: hypothetical protei   g c  a g  a gc gc gc gc gc a  a        a g  |      c  a a  |      a  g c  |      a  a a  |      g  c        g c  |      a  c      g  g c  |      c  c      t  g c  |       gc        cg c  |       gc        gt A  |       cg       |  t A  |       cg       c  t Tg        gc        cg Gc        at        gc A  g       cg        tg Cg        gc        cg Gc        gc        gc |  a       cg        gt |  g       gc        cg Gc        at        cg Gc        cg        cg Cg        cg        cg Cg        cg        cg                         tttttcgtgggtgcggccccccgaccgccagcgccccgggctcggcgccgaacctgtgcacgggactgctaccctccgcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3169 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................