                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctgggggctttttatcgactcgtgagcggcccgctgtcatcagcagggaaccgcacagcattccaattgttcactttgtgacctttccaggccgatcca
aacgcctctccgagagagaaaacccattgttttgcacccgttcaaaagttgtctagtgaacctggtgggtgaaacataagcgggacattaggattccgcc
caagctcaattcggtgtcggttctcaggacctgacagaaagtcgtcgcctgcccatcgtgggtaggccgttactctttttcccttttccccggaggcccc
ATG

    DR0812 Gene: DR0812     GI: 15805838     BI number: DR0812     GOG: COG1404     Description: serine protease, subtilase famil             a           g  a           a  a            cg            at            gc            tg           c  t           c  c           a  g        c            gc       t  g            gc       a  t            at        cg            cg        cg           t  |       cg   c       c  |       gt t  a      t  |       ta c  g      t  |       cg tg        gc        cg ta        gc        gc gc       c  |      c  c gc       t  |      t  g |  t       gc       g  t cg        ta       c  t ta        gt        ta gc        gc        gc ta        cg        at                         ctttttcccttttccccggaggccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1404 Subtilisin-like serine proteases ... can be seen here     ..................................................................................................................